LoxP sites

From IGEM

If we use CRE/LoxP mechanism for inversion we will need to create mutant LoxP sites Lox66 and Lox71. These mutant sites are created using PCR and overlapping primers. These mutant loxP sites will allow for only one inversion and prevent excision because CRE will no longer act on it.

loxP sequence: ataacttcgtatagcatacattatacgaagttat

see Plasmids in the methods section [[1]]

The PCR primers for Lox66 and Lox71 need to be synthesized. The primers include EcoRI and Hind III ( the underlined sections) sites that were used to clone lox66 and lox71 into the plasmid vector (These are the primers found in the above paper.

Lox66 requires primers Z24 and Z25:

Z24: 5'-gcc gaa gct tct cgt gat aac ttc gat tag cat aca tta tac gaa cgg t

Z25: 5'-acc gga att ccc gga cta ccg ttc gta taa tgt atg ct


Lox71 requires primers Z26 and Z27

Z26: 5'-gcc gaa gct tct cgt gta ccg ttc gta tag cat aca t

Z27: 5'acc gga att ccc gga cat aac ttc gta taa tgt atg cta tac gaa cgg t


I also found that if CRE is strongly expressed or transiently expressed by a strong promoter excision is the preffered action. [[2]]

Past/present/future years