BU06:Team C

From IGEM

Image:BU06.jpg
Schedule Research Fundraising Resources Members Contact

Team Goal: Add Restriction Sites to Biobrick Ends

back to the BU iGEM main page

Contents

Members

Melissa Kinney mkinney@bu.edu
Felix Liu fliu@bu.edu
Camilo Garcia camcom1p@bu.edu
Billy Andre bandre@bu.edu

Meeting Schedule

Wednesday July 12th, 3pm Ingalls

  • Goal: Present info on how to isolate from plasmid, how to PCR and add ends, and protocol/primer design
    • I posted a list of links to websites with protocols which should be helpful in designing a plan for our project. This week everyone should look through the websites and become familiar with some of the techniques. Try to create a rough outline of how to approach the experiment and what steps need to be taken from start to end. We have the sequence for our luxCDABE operon, and we have identified AgeI as the restriction site that we will use in doing the PCR reaction. If you copy the sequence into NEB Cutter (link below) you can see where all of the restrition sites are, including AgeI. Start to think about how we would design primers and maybe even give it a shot. Feel free to post anything you find or any questions you encounter on the wiki so that we can use it as a forum for ideas and progress. You can also e-mail any questions or ideas to me and i'll put it up on the wiki. We'll meet to go over everything that we have found out this week and then present our progress at the general meeting.


Wednesday July 26th, 3pm Ingalls

  • Goal: Discuss details of research presentation for general meeting (7/26/06 4pm), go over lab manual and protocols
    • Our group has signed up to give the first presentation during the general meeting. We have to create a formal presentation (not just a discussion) of all of the techniques that we have researched and our plan for conducting our experiment. I am currently working on a powerpoint presentation, which we will go over during our meeting. I would like it if the other team members can gain enough understanding of our project in order to give the presentation during the general meeting. Before our meeting, try to go over the plan and protocols which I have posted on the wiki so that we are all on the same page with our research. I am also in the process of putting together a little lab manual with all of the techniques which will be important to our experiment. We probably won't do an actual lab training because I don't want to waste materials. Instead, we will discuss all of the techniques and make sure that there is complete understanding of the purpose of each technique and how it works.

Current Progress

  • Isolation of luxCDABE:The luxCDABE operon has been designed such that it can be removed from the pUC19 plasmid by EcoRI sites that are at the very beginning and ends. This makes it easy to isolate the operon from pUC19 in order to add the restriction sites to the ends.
  • Adding Ends: PCR is one way to add restriction sites onto the ends of a sequence. Primers can be designed which will anneal to the gene, yet have an overhang which includes the restriction site(s). The problem arises in the length of our operon. At nearly 7000bp, the operon is too long for PCR to amplify all of it (standard PCR is only efficient up to about 5000bp according to our PCR master mix). Therefore, the PCR reaction must be preformed in different parts, cut with a restriction enzyme in the middle and ligated into one piece. We will use the AgeI restriction site in the middle where two PCR reactions will overlap.
    • End Sequences: The sequences which we need to add to the beginning and ends of the operon can be found in the registry. Part BBa_G00000 is the prefix sequence, and part BBa_G00001 is the suffix sequence.
GAATTCGCGGCCGCTTCTAGAG
EcoRI site found in the sequence at base pair 1.
XbaI site found in the sequence at base pair 16.
NotI site found in the sequence at base pair 7.

TACTAGTAGCGGCCGCTGCAG
SpeI site found in the sequence at base pair 2.
PstI site found in the sequence at base pair 16.
NotI site found in the sequence at base pair 9.
  • The experiment design can be simplified by not cutting the operon out of the plasmid first. The PCR reaction can be preformed directly on the plasmid, using primers which begin annealing halfway through the EcoRI site (to eliminate the site) and include an overhang with the restriction sites.
  • One consideration is the isolation of the operon without the current promoter, so that we are able to insert our own promoter in order to control the expression of lux. The best way to do this is just to design a primer as close to the start site of the first gene as possible.

Experiment Design and Protocols (pdf)

Design Outline:

1. Isolate the plasmid DNA from the stock cells
- Grow stock cells with vector on agar + ampicillin plate overnight
- Choose colony of cells from the plate and grow overnight in liquid media + ampicillin
- Miniprep to remove DNA from cells
2. Add restriction sites to the ends of the operon
- PCR reaction with forward/middle reverse primer
- PCR reaction with middle forward/reverse primer
- Clean up PCR reactions (using PCR purification kit)
- Digest with AgeI
- Run on gel and isolate large fragments
- Clean up gel excision (using gel extraction kit)
- Ligate two digested fragments together
3. Verify results
- Run 5ul of ligation product on gel to see the size (~7kb)
  • It seems that we can just add one restriction site onto each end of the biobrick. This is possible because we can take an existing biobrick and use XbaI/SpeI to cut out the existing parts. With XbaI/SpeI on the ends of our biobrick, it can then be ligated into this vector. This makes the PCR easier because the overhang is smaller, thus decreasing the chances of non specific binding to other areas of the plasmid.

Primers

Lux Forward:
ATAATAT TCTAGA TGGATGGCAAATATGACTAAAAAAATTTCATTC

Lux Middle Reverse:
CACTCAGTCGTCGAAGCT
Lux Middle Forward:
GGTAAAAGTAAACCCCGCG

Lux Reverse:
ATAATAT ACTAGT GAATTCCTTTAATCCCTTTAATTCCTGGAT

Powerpoint Presentation (pdf) given at the general meeting on 7/26/06

Questions

  • How can we test if the restriction sites have been added successfully?
  • Is it possible to run ligation product on gel or does it need to be cleaned up first?

References

Techniques

Protocols

Tools

Past/present/future years